SARS-CoV-2’s mikroproteiner er veldig vanlige

I dag spør mange seg: «Er vi på vei inn i et helsediktatur med Covid-19 som skalkeskjul? Her er enda en grunn til å stille dette spørsmålet: – Dagens «Coronatester» sjekker bare om det finnes tre-fem mikroproteiner i prøven fra nese/hals, men nå viser det seg at de samme mikro-proteinene er svært vanlige. – Det er altså ikke bare det at en PCR-test er tvilsom i seg selv, MEN når Coronatesten gir utslag, vet du ALDRI årsaken til utslaget fordi DNA-sekvensene aldeles ikke er unike for det antatte SARS-CoV-2-viruset. Tvert imot finnes de samme sekvensene i over 100 vanlige bakterier og ca 74 sekvenser av DNAet til mennesker. Du kan faktisk sjekke selv at disse sekvensene er veldig utbredt i naturen! – Er det rart da at det er så mange «positive Coronatester» verden over?

 

Illustrasjon er fra en artikkel @Principia Scientific International

Karma Singh skriver: «Ekte empiri gir et ugjendrivelig bevis» og «Hvordan beviser du eksistensen av et virus som ingen kan finne?» «Svar: Jo: Du later som at det er andre ting som beviser at viruset eksisterer.» Det er dette denne artikkelen egentlig handler om!
Det er en enorm forskjell på den «vitenskapen» som Corona-lederne i WHO, Norge og verden for øvrig viser til og det som Dr. Karma Singh snakker om. – Det er nettopp empiri som avviser at SARS-CoV-2-viruset eksisterer når en lege Singh forteller hvordan  Dr. Blancha, sjekker mot en omfattende database over DNA om DNA-sekvensene er kjent fra før!

«Har dere SARS-CoV-2-viruset»?

De aller fleste demokratiske land i verden har et lovverk som med noen unntak lar «informerte innbyggere» (sic!) kreve at offentlig informasjon blir utlevert. Også Norge har et lovverk om dette, nemlig «Lov om rett til innsyn i dokument i offentleg verksemd eller offentlighetsloven« der det bl. a. sies.

«Hovedregelen er at alle kan kreve innsyn i saksdokumenter, journaler og andre lignende registre. Loven inneholder også bestemmelser om hva som regnes som dokument og når et dokument blir offentlig. Loven gjelder ikke for Stortinget, Riksrevisjonen og Stortingets ombudsmann for forvaltningen (Sivilombudsmannen). Den gjelder heller ikke for domstolene.»

I engelskspråklige land kalles slike lover «Freedom of Information Acts» (FOI eller FOIA i USA). Ved å henvise til slike FOI har gravende journalister og forskere i over 40 land bedt forsknings-laboratorier over nesten hele verden om de kan oversende isolatet av SARS-CoV-2-viruset. Dette er svaret det har fått:

«Freedom of Information applications in more than 40 countries have, uniformly, brought the answer, “We do not have and do not know of any government or private institute or laboratory which has a specimen of the virus.”«

«Vi har ikke og vet ikke om noen regjering eller privat institutt som har noe eksemplar av viruset»

SÅ LANGT HAR ALTSÅ IKKE ET ENESTE FORSKNINGSINSTITUTT I VERDEN BEKREFTET AT DE HAR SARS-CoV-2 I NOEN SOM HELST FORM.

Den opplagte konklusjonen er selvsagt at viruset ikke finnes. Det funnet bekreftes faktisk i mange titalls kilder; her og her er bare to av dem. Dermed kan en også konkludere med at SARS-CoV-2 er en rent teoretisk konstruksjon.

Å konstruere et virus

Som vi skal se, viser det seg at de bedragerne som står bak Plandemien har tatt utgangspunkt i 3 – 5 veldig vanlige mikroproteiner (alleler). Resten, altså over 99,1 % av SARS-CoV-2-viruset, er en datamodell som bygd rundt disse tre mikroproteinene og som angivelig skal ligne de andre Coronavirusene, som faktisk heller ikke er isolert noen gang!

Men for å hoppe litt tilbake i tid: I november 2013 ble det oppdaget at et bestemt mikroprotein (på 1/1000 av størrelsen til et virus) var veldig vanlig – faktisk spredt i hele verden.
Så, da banden omkring WHO/GAVI/Bill Gates & World Economic Forum skulle lage enda en kunstig pandemi, valgte de nettopp dette mikroproteinet til å være en av hjørnesteinene i det såkalte SARS-CoV-2-viruset! – Akkurat når de startet å planlegge «Covid19» er litt vanskelig å finne ut av, men det antydes flere steder at disse kreftene har holdt på i mange år, kanskje siden 2014-2015 eller mye lenger tilbake??
Drøye påstander, sier du? Ja, det virker så utrolig at noen mennesker får seg til å gjøre noe slikt MED VILJE, at mange trekker seg tilbake og ikke ønsker å se.
Men det finnes faktisk veldig god dokumentasjon på at det er dette som har skjedd, blant annet artikkelen jeg allerede har nevnt: «Irefutable Scientific Proof – Covid-19 Does NOT Exist» fra 20. februar 2021 av Dr. Karma Singh, her og her.
Se også artiklene «A Private-Public Partnership That Created A Pandemic:» Part 1 & 2, her og her.

Men først noen definisjoner:

  • Ordet genom betyr det fullstendige oppbygningen DNAet (ev. RNAet), uansett om vi snakker om et virus, en bakterie, en plante, et pattedyr eller et menneske.
  • Som kjent består DNA av 4 helt bestemte aminosyrer: A, T og C, G Bokstavene står for henholdsvis Adenin, Tymin og Cytosin og Guanin.

Når jeg har skrevet bokstavene som to par, er det fordi at Adenin ALLTID knytter seg til Tymin på motsatt side av spiralen og det samme gjør Cytosin med Guanin. Når så genetikerne skal beskrive en sekvens, sløyfer de proteinene på den ene siden av spiralen (heliksen) og skriver for eksempel bare høyresiden på bildet nedenfor som «TCAG».

Like aminosyrer kan ligge ved siden av hverandre, men f. eks. ‘AA’ eller ‘GG’ vil da alltid ha ‘TT’ eller ‘CC’ på motsatt side av heliksen. Slike korte sekvenser kalles nukleotider.

Se en mer utførlig forklaring her.

Sjekk av de genetiske sekvensene

I artikkelen » Irrefutable Scientific Proof – Covid-19 Does NOT Exist!» refererer Singh blant annet til arbeidet som spanske dr. Jesus Garcia Blanca har gjort. Hele avsnittet er så viktig at jeg siterer det først og oversetter etterpå:

“What Dr. Blanca has done is to take the genetic sequence of the Sars-Cov-2 protein fragment and, using the database of the National Institute of Health in America, has searched for and found all organisms which contain the Sars-Cov-2 fragment as part of their genome. The results of his search are most edifying:
* More than one hundred known bacteria contain the Sars-Cov-2 fragment.
* 74 sequences of the human genome also contain the Sars-Cov-2 fragment.
Any PCR or any test which finds Sars-Cov-2 is not only so unspecific as to be totally meaningless but also is not evidence of any kind for the presence of a Covid-19 virus.”

* * *

«Det dr. Blanca har gjort er å ta de genetiske sekvensene til (det tidligere omtalte) SARS-CoV-2-proteinet og gjennom å søke i databasen til Det Amerikanske Helseinstituttet (USA), funnet alle organismene som inneholder SARS-CoV-2-fragmentene som en del av deres genom (= det totale DNAet). Resultatet av søket hans er virkelig oppklarende:

* Mer enn et hundre kjente bakterier inneholder SARS-CoV-2-fragmetet
* 74 sekvenser av det menneskelige genomet inneholder også SARS-CoV-2-fragmentet

Altså er en hvilken som helst PCR eller annen test som finner SARS-CoV-2 på sykler over 26 ikke bare så uspesifikk at det er fullstendig meningsløst, men den er heller ikke et bevis på noen som helst måte for tilstedeværelsen av Covid-19-viruset.

Jeg skal ikke gå gjennom alle detaljene, men bare ta for meg det mye omtalte S-proteinet som utgjør spirene på datategningene av SARS-CoV-2-viruset. Det er disse spirene som angivelig skal gjøre viruset i stand til å trenge inn i ei celle. Når da mRNA-vaksinene er programmert til å angripe nettopp dette proteinet, så finnes det samme proteinet også finnes i morkaker og i spermia. Dermed risikerer de vaksinerte å bli ufruktbare for ukjent tid etter at de har fått vaksinen!

Teknisk sett er S-proteinet langt; det består av 3821 nukleotider som alle ligger mellom posisjonene 21.563 og 25.384 i DNA-kjedene. Dette gjorde at dr. Jesus Garcia Blanca valgte å bare ta utvalgte nøkkelområder på proteinet

Sekvens A:     TTGGCAAAATTCAAGACTCACTTTC
Resultat:    sekvensen gav treff på mer enn 100 kjent bakterier og 93 kjente sekvenser fra det menneskelige genomet
Sekvens B: CTTGCTGCTACTAAATGCAGAGTGT
Resultat:    sekvensen gav treff på nye 100 kjente bakterier og 93 kjente sekvenser fra det menneskelige genomet

Hadde SARS-CoV-2 vært et unikt og eksisterende virus, ville det ha vært tilnærmet NULL treff på andre DNA-sekvenser. 

  • En engelsk oversettelse fra spansk om detaljene i arbeidet til Jesus Garcia Blanca, finnes i denne artikkelen; se avsnittene fra » LOOKING FOR THE ORIGIN OF THE FALSE GENOME» og framover. Der er det også en oppskrift på hvordan en kan sjekke disse sekvensene selv.

Bedraget har store konsekvenser

«Coronakrisen» har allerede ødelagt livet til et veldig stort antall mennesker, og det til tross for at sykdommen slett ikke er alvorligere enn en gjennomsnittlig influensaepidemi (faktisk er det sannsynlig at «Covid19» ER en vanlig influensaepidemi!)

  • Sykdommer som kreft, nevrologiske lidelser, lungesykdommer og hjerte-karlidelser har fått et sterkt redusert behandlingstilbud. Jeg ser flere statistikere hevde at den toppen som kom i antall døde i mars-mai 2020 mer sannsynlig skyldes den sviktende oppfølgingen av disse pasientgruppene enn at det har sammenheng med «Corona».
  • I løpet av et års tid har tallet på små og mellomstore bedrifter sunket dramatisk. Det sies for eksempel fra USA at tiltakene mot Covid19 har gjort at 48 % av små bedrifter har opphør. Jeg er redd for at situasjonen er likedan i Norge og resten av Europa.
  • Ungdommer har fått et kraftig redusert eller endret utdanningstilbud og mistet eksamener
  • Lag- og foreningsliv er i dvale nå på andre året
  • Musikere, skuespillere og andre utøvende kunstnere har mistet store inntekter og trolig også kundegrupper
  • Idrettsutøvere har fått amputerte sesonger og arrangørene har mistet store inntekter
  • Det har blitt vanskeligere for den jevne mann og kvinne å holde seg i fysisk form
  • Barn og unge melder om store psykiske problemer. Bare i England forteller halvparten av ungdommene mellom 16 og 25 år at den mentale helsen deres har blitt forverret siden starten på epidemien (her og her). Et økende antall selvmord og press på hjelpetelefoner vitner om det samme.
  • På toppen av det hele er det utstedt generelt påbud om bruk av munnbind også for barn og unge, noe som forverrer denne krisen og har stort potensiale til å ødelegge helsen til utallige mennesker. De fleste barn og unge tar faktisk skade av å bruke munnbind, se her.
  • Krav om sosial avstand øker presset for alle, fordi vi som mennesker er sosiale vesener. Særlig barn, men også unge og voksne, er avhengig av fysisk kontakt (av stimulering av den taktile sansen) for en normal utvikling og for vår egen helse (blant annet senker fysisk kontakt blodtrykket vårt) og for våre kognitive evner!

Brødteksten under videoen på BitChute sier «Juristen Dr. Reiner Fuellmich legger fram en veldig klar og rasjonell analyse av dagens verdensvide psykologiske manipulasjon» sier hans. Vidoen har tittelen «Dr. Reiner Fuellmich – CRIMES AGAINST HUMANITY» og er en av de videoene som MÅ SEES!
– Jeg har forresten oversatt til norsk en lettere forkortet versjon av intervjuet Rainer Fuellmich hadde med Astrid Stuckelberger, der koblingen mellom WHO/GAVI og Bill Gates blir forklart, se her.
Selv om det er tungt lesestoff, er dokumentet «Retraction request letter to Eurosurveillance editorial board, CORMAN-DROSTEN REVIEW REPORT – CURATED BY AN INTERNATIONAL CONSORTIUM OF SCIENTISTS IN LIFE SCIENCES (ICSLS)» av 28. november 2020, den mest avgjørende falsifiseringen av de dokumentene som RT-PCR-testen bygger på. Jeg anbefaler enda en gang alle å ta den jobben det er å arbeide seg gjennom de 10 punktene i avvisningen av «Coronatesten». Avvisningen ligger her.

Konklusjon:

Ta deg tid til å tenke over resultatet fra undersøkelsen til dr. Jesus Garcia Blanca!
Mer enn 100 kjente bakterier og 74 sekvenser i det ‘menneskelige genomet (DNAet) inneholder det samme mikroproteinet som dem som er bygd inn i SARS-CoV-2-viruset.
Er det rart at «Coronatesterne» finner mange «smittetilfeller»?
Hvert eneste «smittetilfelle» med Corona, hver eneste «Coronainnleggelse», hvert eneste «Coronadødsfall», Lock Down, maskepåbud, Social Distancing og så videre bygger altså på ren og skjær løgn!
Et annet moment er at et virus som aldri er isolert kan heller ikke mutere! … Hvert eneste oppslag om nye mutasjoner er en ren og skjær bløff. Hvordan kan et konstruert virus, som ikke eksisterer som noe annet enn som en datamodell mutere?
Hvert eneste ‘rop’ om «smitte, smitte, smitte» i nyheter, i idrettssammenheng, i transportselskaper og i kommunestyre-møter bygger altså på ren og skjær løgn; på forbrytelse mot menneskeheten, slik Reiner Fuellmich sier det!
Dette kjennes enda verre ut når en vet at WHO/GAVI og myndighetene kan styre nye bølger av plandemien som de vil ved å regulere antall cykler i PCR-verktøyet, se her? Du kan jo se selv hvor de lavere tersklene på «Coronatesten» faller inn på grafene over antall Covid-19-kasus, her. …»

Etterskrift

Khari Mullis sa før han døde at HVIS noen skulle bruke RT-PCR-verktøyet hans i diagnostisk sammenheng, var det meningsløst å kjøre det med mer enn 26 sykler. Tidligere har WHO anbefalt at RT-PCR kjøres med 40-43 sykler (noen har brukt helt opp til 46 sykler), stikk i strid med all sunn fornuft!
Den 13. januar reduserte WHO antall anbefalte sykluser til 25 og forandret også en PCR test til å være et støtteredskap og ikke en test som skulle lede til diagnose av Covid. Men som Astrid Stuckelberger sier: «Den informasjonen er veldig godt gjemt i anbefalingene og er skrevet med liten skrift«, se her!
Det ser altså ut til at kommuneleger, politikere og journalister har fortrengt at det er helt bestemte kriterier som MÅ være på plass for at en skal kunne snakke om et sykdomskasus.
Noen av betingelsene er at sykdommen må ha unike symptomer og ikke dele symptomer, utbredelse, sykelighet og dødelighet med noen andre sykdommer; heller ikke med vanlig sesonginfluensa, slik «Covid19» gjør.
Under «Coronakrisen» har de styrende bare sett på resultatene av ei laboratorieprøve, som er så tvilsom at oppfinneren av RT-PCR, Kharis Mullis, sa at RT-PCR er et verktøy til bruk i mikrobiologiske laboratorier og at den kan ALDRI brukes til å påvise noen bestemt sykdom, se her og her.

Er dere klar over alt dette, kjære politikere, helsebyråkrater og journalister?

Dette nettstedet bruker Akismet for å redusere spam. Lær om hvordan dine kommentar-data prosesseres.